Non-radioactive Probes

Via random hexamers

  1. Solutions:
    10x Hexanucleotide Mix (supplied with kit)
    • 500 mM Tris-Cl pH 7.2
    • 100 mM MgCl2
    • 1 mM dithioerythritol (DTE)
    • 2 mg/ml BSA
    • 62.5 A260 units/ml (1.56 mg/ml) random hexanucleotides

    10x digoxigenin/dNTP Mix (supplied with kit)
    • 1 mM dATP
    • 1 mM dCTP
    • 1 mM dGTP
    • 0.65 mM dTTP
    • 0.35 mM alkali-labile digoxigenin (dig)-UTP

  1. Reactions:
    1. Heat at 100oC for 10 minutes to denature DNA. Use 15 ul (50-250ng) DNA in TE or distilled H2O.

    2. Cool quickly on ice for 1-2 minutes.

    3. Add:

      1. 2 ul 10X hexanucleotide mix.

      2. 2 ul 10X digoxigenin/dNTP mix.

      3. 1 ul Klenow (5units/ul) supplied with kit.

    4. Incubate at 37oC for 1-20 hours

    5. Increase volume to 50 ul and add 5 ul 0.4 M EDTA pH8.0.

    6. Purify through a G-50 spin column.

Via PCR

  1. Solutions:
    10x PCR buffer
    • 100 mM Tris-Cl, pH 8.3
    • 500 mM KCl

    10x digoxigenin/dNTP Mix (supplied with kit)
    • 2 mM dATP
    • 2 mM dCTP
    • 2 mM dGTP
    • 1.3 mM dTTP
    • 0.7 mM alkali-labile digoxigenin (dig)-UTP

  1. Reactions:
    • 33 ul distilled H2O
    • 5 ul 10X PCR buffer
    • 3 ul 25 mM MgCl2
    • 5 ul 10X digoxigenin mix
    • 1 ul oligo 1 (use 20 pmoles)
    • 1 ul oligo 2 (use 20 pmoles)
    • 1 ul Template
    • 1 ul Taq 1

    1. To purify, spin through a G-50 column or gel-isolate fragment (depending on the purity of the amplification).
  1. PCR conditions:
    94oC for 5 minutes
    94oC for 30 seconds
    59oC for 1 minute
    70oC for 2 minutes
      ==> 35 cycles
    4oC hold

    1. Purify through a G-50 spin column.

Riboprobe Synthesis

  1. Solutions:
    10x NTP mixture
    • 10 mM ATP
    • 10 mM CTP
    • 10 mM GTP
    • 6.5 mM UTP
    • 03.5 mM digoxigenin (dig)-UTP

  1. Reactions:
    1. Add the following reagents in order on ice:

      • 13 ul Purified template* (1 ug) plus distilled H2O
      • 2 ul NTP mix
      • 2 ul 10x Transcription buffer
      • 1 ul RNase Inhibitor
      • 2 ul RNA polymerase (SP6, T3, or T7)

        *Purified template can be from a variety of sources:

        From Vectors: To avoid transcription of undesirable sequences from a linearized vector, cut vector with enzyme which leaves 5' overhangs or blunt ends, then gel purify.

        From PCR products: One can design PCR primers that include either a T3 or T7 promoter in the 5' end of the primer. Simply run the PCR and then gel purify fragment.
            For T3: ATCGAAATTAACCCTCACTAAAGGG
            For T7: ATCGATAATACGACTCACTATAGGG

    2. Incubate for 2 hours at 37oC.

    3. Add 2 ul DNase I and incubate 15 minutes at 37oC.

    4. Add 2 ul 0.2 M EDTA to stop reaction.

    5. Purify on G-50 column.

End-labeling Ladder

  1. On ice mix:

    • 32 ul sample (10 ug 1kb BRL ladder plus distilled H2O)
    • 5 ul 10x TMD (500 mM Tris-Cl pH 7.5, 100 mM MgCl2, 100 mM DTT)
    • 2 ul 10x Transcription buffer
    • 1 ul digoxigenin-UTP
    • 2 ul T4 DNA polymerase

  2. Incubate for 5 minutes at 37oC.

  3. On ice mix:
    • 5 ul 1mM dATP, dGTP mix
    • 5 ul 1mM dCTP

  4. Incubate for 15 minutes at 30oC.

  5. Add 6 ul stop solution (2% Sarkosyl, 0.4M EDTA pH8.0).

  6. Purify on G-50 column.